Detail of EST/Unigene BQ125005 |
Acc. | BQ125005 |
Internal Acc. | EST610581 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=1e-24; Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=9e-24; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=3e-23; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-23; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. indica E-value=3e-23; |
Length | 528 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | GCTGTATCGAAAAAATAAATATATTCCATGTGGTGGCATGTCATTCCGGGTTATTATCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |