Detail of EST/Unigene BQ137104 |
Acc. | BQ137104 |
Internal Acc. | NF067D11STT1F109 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase-like protein 1 OS=Arabidopsis thaliana E-value=1e-07; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=3e-07; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=7e-07; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=7e-07; Glucan endo-1,3-beta-glucosidase-like protein At1g69295 OS=Arabidopsis thaliana E-value=2e-06; |
Length | 771 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | TGATACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 3767975 |
Trichome-related Gene from Literature | N/A |