| Detail of EST/Unigene BQ137963 |
| Acc. | BQ137963 |
| Internal Acc. | NF007H03PH1F1031 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=5e-50; Glucan endo-1,3-beta-glucosidase A OS=Solanum lycopersicum E-value=7e-47; Lichenase OS=Nicotiana plumbaginifolia E-value=9e-47; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=1e-46; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=1e-46; |
| Length | 646 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA; |
| Sequence | TTGGTTTATACTTTGGTATAATTAAAGCAATACATTCTTAAAAAGAAACTCTTCGATTGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827320 |
| Trichome-related Gene from Literature | N/A |