Detail of EST/Unigene BQ137963 |
Acc. | BQ137963 |
Internal Acc. | NF007H03PH1F1031 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=5e-50; Glucan endo-1,3-beta-glucosidase A OS=Solanum lycopersicum E-value=7e-47; Lichenase OS=Nicotiana plumbaginifolia E-value=9e-47; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=1e-46; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=1e-46; |
Length | 646 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | TTGGTTTATACTTTGGTATAATTAAAGCAATACATTCTTAAAAAGAAACTCTTCGATTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827320 |
Trichome-related Gene from Literature | N/A |