| Detail of EST/Unigene BQ137991 |
| Acc. | BQ137991 |
| Internal Acc. | NF012A01PH1F1001 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thermospermine synthase ACAULIS5 OS=Arabidopsis thaliana E-value=1e-65; Spermidine synthase OS=Thermoanaerobacter sp. (strain X514) E-value=7e-31; Spermidine synthase OS=Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E) E-value=7e-31; Spermidine synthase 1 OS=Thermoanaerobacter tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4) E-value=4e-30; Spermidine synthase OS=Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903) E-value=3e-29; |
| Length | 586 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA; |
| Sequence | ATGCGAGGTGCATTTTCAACAAATAAAACCATGGGAGAGGCACCAGAAATGTTTTACTGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00797 spermidine synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00797 spermidine synthase |
| EC | 2.5.1.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 832073 |
| Trichome-related Gene from Literature | N/A |