| Detail of EST/Unigene BQ138194 |
| Acc. | BQ138194 |
| Internal Acc. | NF020G06PH1F1052 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Shaggy-related protein kinase theta OS=Arabidopsis thaliana E-value=2e-65; Shaggy-related protein kinase theta OS=Brassica napus E-value=1e-63; Shaggy-related protein kinase epsilon OS=Arabidopsis thaliana E-value=1e-63; Shaggy-related protein kinase beta OS=Arabidopsis thaliana E-value=1e-62; Shaggy-related protein kinase NtK-1 OS=Nicotiana tabacum E-value=1e-61; |
| Length | 429 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA; |
| Sequence | GATAATCTCATACATGGCAGAACGTGTCGTTGGTACCGGTTCTTTTGGCGTTGTTTATCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03083 glycogen synthase kinase 3 beta |
| EC | 2.7.11.26 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828023 |
| Trichome-related Gene from Literature | N/A |