| Detail of EST/Unigene BQ138225 |
| Acc. | BQ138225 |
| Internal Acc. | NF001A09PH1F1067 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Zeaxanthin epoxidase, chloroplastic OS=Prunus armeniaca E-value=2e-28; Zeaxanthin epoxidase, chloroplastic OS=Nicotiana plumbaginifolia E-value=1e-22; Zeaxanthin epoxidase, chloroplastic OS=Solanum lycopersicum E-value=9e-22; Zeaxanthin epoxidase, chloroplastic OS=Arabidopsis thaliana E-value=5e-18; Zeaxanthin epoxidase, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-17; |
| Length | 624 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA; |
| Sequence | CACACTATTTTTCTCTTTTATCTCTTCTTCTTTCAATATTTGCTAAAATTATAGTTAATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836838 |
| Trichome-related Gene from Literature | N/A |