| Detail of EST/Unigene BQ138264 |
| Acc. | BQ138264 |
| Internal Acc. | NF001D10PH1F1080 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Estradiol 17-beta-dehydrogenase 12 OS=Rattus norvegicus E-value=8e-26; Estradiol 17-beta-dehydrogenase 12 OS=Macaca fascicularis E-value=5e-25; Putative steroid dehydrogenase let-767 OS=Caenorhabditis briggsae E-value=7e-25; Estradiol 17-beta-dehydrogenase 12 OS=Mus musculus E-value=9e-25; Estradiol 17-beta-dehydrogenase 12-B OS=Xenopus laevis E-value=1e-24; |
| Length | 644 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA; |
| Sequence | CTCCCTTCATCTTTACAATAAATCCATTGCTGCTACTCTCATTTTTTTCATAAATAAATC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00044 estradiol 17beta-dehydrogenase; ; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10251 beta-keto reductase |
| EC | 1.1.1.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843098 |
| Trichome-related Gene from Literature | N/A |