Detail of EST/Unigene BQ138282 |
Acc. | BQ138282 |
Internal Acc. | NF001E06PH1F1049 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP24 10B, chloroplastic OS=Solanum lycopersicum E-value=3e-83; Chlorophyll a-b binding protein CP24 10A, chloroplastic OS=Solanum lycopersicum E-value=4e-83; Chlorophyll a-b binding protein CP24, chloroplastic OS=Spinacia oleracea E-value=2e-81; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=2e-24; Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=4e-22; |
Length | 635 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | CAAAACCAGTCTCATTACTCTTTATCTCTAGAAGACAAATGGCAGCCTGCAACATCTGGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838151 |
Trichome-related Gene from Literature | N/A |