Detail of EST/Unigene BQ138445 |
Acc. | BQ138445 |
Internal Acc. | NF003D07PH1F1060 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Branched-chain-amino-acid aminotransferase 2, chloroplastic OS=Arabidopsis thaliana E-value=8e-40; Branched-chain-amino-acid aminotransferase 1, mitochondrial OS=Arabidopsis thaliana E-value=3e-35; Putative branched-chain-amino-acid aminotransferase 7 OS=Arabidopsis thaliana E-value=8e-35; Branched-chain-amino-acid aminotransferase 5, chloroplastic OS=Arabidopsis thaliana E-value=8e-35; Branched-chain-amino-acid aminotransferase 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-34; |
Length | 661 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | GTTGTATAAAAAATTGCTACGTAGCAACCAAAATAACTATATATATGCAGATTGCATATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00290 Valine, leucine and isoleucine biosynthesis > K00826 branched-chain amino acid aminotransferase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K00826 branched-chain amino acid aminotransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K00826 branched-chain amino acid aminotransferase |
EC | 2.6.1.42 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837543 |
Trichome-related Gene from Literature | N/A |