| Detail of EST/Unigene BQ138475 |
| Acc. | BQ138475 |
| Internal Acc. | NF003F04PH1F1041 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L24, chloroplastic OS=Pisum sativum E-value=7e-71; 50S ribosomal protein L24, chloroplastic OS=Arabidopsis thaliana E-value=4e-62; 50S ribosomal protein L24, chloroplastic OS=Nicotiana tabacum E-value=6e-61; 50S ribosomal protein L24, chloroplastic OS=Spinacia oleracea E-value=2e-52; 50S ribosomal protein L24 OS=Synechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6) E-value=3e-33; |
| Length | 662 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA; |
| Sequence | CAAAAATGGTAGCTATGGCTATGGCTTCTCTTCAGAGTTCCATGACCTCACTCTCACTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835549 |
| Trichome-related Gene from Literature | N/A |