Detail of EST/Unigene BQ138503 |
Acc. | BQ138503 |
Internal Acc. | NF004A11PH1F1083 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit III, chloroplastic OS=Flaveria trinervia E-value=9e-65; Photosystem I reaction center subunit III, chloroplastic OS=Arabidopsis thaliana E-value=7e-62; Photosystem I reaction center subunit III, chloroplastic OS=Spinacia oleracea E-value=9e-62; Photosystem I reaction center subunit III, chloroplastic OS=Hordeum vulgare E-value=7e-55; Photosystem I reaction center subunit III OS=Guillardia theta E-value=6e-35; |
Length | 640 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | CTCCCTCTTCTCTTCTTCTTCCACACAAAAATGTCTCTAACAATTCCAACTAACCTCTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840021 |
Trichome-related Gene from Literature | N/A |