Detail of EST/Unigene BQ138511 |
Acc. | BQ138511 |
Internal Acc. | NF004B10PH1F1079 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chorismate synthase 1, chloroplastic OS=Solanum lycopersicum E-value=6e-21; Chorismate synthase 2, chloroplastic OS=Solanum lycopersicum E-value=1e-20; Chorismate synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-19; Chorismate synthase, chloroplastic OS=Corydalis sempervirens E-value=3e-18; Chorismate synthase OS=Shigella sonnei (strain Ss046) E-value=7e-15; |
Length | 352 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | ATCAAACAAAGATTATTNCATTTCATTTCCCAATAGCCATAGCAATAGCCATGGCTTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841307 |
Trichome-related Gene from Literature | N/A |