Detail of EST/Unigene BQ138646 |
Acc. | BQ138646 |
Internal Acc. | NF005F06PH1F1058 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 13S-lipoxygenase 3-1, chloroplastic OS=Solanum tuberosum E-value=0; Lipoxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=0; Lipoxygenase 3, chloroplastic OS=Arabidopsis thaliana E-value=0; Probable lipoxygenase 6 OS=Oryza sativa subsp. japonica E-value=8e-89; Putative lipoxygenase 5 OS=Oryza sativa subsp. japonica E-value=4e-88; |
Length | 684 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | GCAATGCATCCAATTTTCAAGTTATTGGATCCACACATGAGGTACACTTTGGAGATCAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00461 arachidonate 5-lipoxygenase; ; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08022 arachidonate 15-lipoxygenase (second type) / 8-lipoxygenase (S-type) |
EC | 1.13.11.- 1.13.11.33 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843584 |
Trichome-related Gene from Literature | N/A |