Detail of EST/Unigene BQ138664 |
Acc. | BQ138664 |
Internal Acc. | NF005E11PH1F1086 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 1-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-37; Thioredoxin-like 1-2, chloroplastic OS=Arabidopsis thaliana E-value=2e-34; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-34; Thioredoxin-like 1-1, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-32; Thioredoxin-like 1-3, chloroplastic OS=Arabidopsis thaliana E-value=3e-30; |
Length | 676 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | CGTTGTTCTTTTTTTCTCTCTCTAACATTTTTTACTCTCTTCAAAATTCAAAGGTTTTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837379 |
Trichome-related Gene from Literature | N/A |