| Detail of EST/Unigene BQ138718 |
| Acc. | BQ138718 |
| Internal Acc. | NF006C11PH1F1085 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase, chloroplastic OS=Pisum sativum E-value=7e-93; Carbonic anhydrase, chloroplastic OS=Arabidopsis thaliana E-value=1e-61; Carbonic anhydrase, chloroplastic OS=Spinacia oleracea E-value=1e-58; Carbonic anhydrase, chloroplastic OS=Nicotiana tabacum E-value=2e-57; Carbonic anhydrase OS=Flaveria brownii E-value=2e-53; |
| Length | 678 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA; |
| Sequence | CTTCCATAAACGGCTTTAGTCTCTCTTCTTTGTCCCCTACAAAAACTTCTATTAAAAAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821134 |
| Trichome-related Gene from Literature | N/A |