Detail of EST/Unigene BQ138880 |
Acc. | BQ138880 |
Internal Acc. | NF008F09PH1F1076 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=3e-31; Geraniol 8-hydroxylase OS=Swertia mussotii E-value=7e-31; 7-ethoxycoumarin O-deethylase OS=Helianthus tuberosus E-value=6e-27; Cytochrome P450 76C3 OS=Arabidopsis thaliana E-value=2e-22; Cytochrome P450 76C4 OS=Arabidopsis thaliana E-value=1e-21; |
Length | 668 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | GAAGTCCTTTGGGAGTGTAGCATCTATATATCCTGGTTGATTTCTTGTGCTTGAGAAAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J |
EC | 1.14.14.1 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825276 |
Trichome-related Gene from Literature | N/A |