| Detail of EST/Unigene BQ138919 |
| Acc. | BQ138919 |
| Internal Acc. | NF009B02PH1F1013 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=2e-87; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=4e-68; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum tuberosum E-value=4e-66; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum lycopersicum E-value=9e-65; Oxygen-evolving enhancer protein 2-1, chloroplastic OS=Nicotiana tabacum E-value=1e-63; |
| Length | 637 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA; |
| Sequence | CTAGACTCTAGCAAAATGGCCTCTACACAATGCTTCTTGCACCCCCAATATGCTCTTACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837178 |
| Trichome-related Gene from Literature | N/A |