| Detail of EST/Unigene BQ138958 |
| Acc. | BQ138958 |
| Internal Acc. | NF009F01PH1F1011 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chaperone protein ClpB4, mitochondrial OS=Arabidopsis thaliana E-value=2e-24; Chaperone protein ClpB3, mitochondrial OS=Oryza sativa subsp. japonica E-value=3e-24; Chaperone protein ClpB3, chloroplastic OS=Arabidopsis thaliana E-value=2e-17; Chaperone protein ClpB2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-16; Chaperone protein ClpB OS=Gloeobacter violaceus (strain PCC 7421) E-value=1e-08; |
| Length | 607 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA; |
| Sequence | TGACGATAGCAAATGGAATATGAGTTTGGCCCCTTCTCCAAGCTTCGAGAGACACCCATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817052 |
| Trichome-related Gene from Literature | N/A |