Detail of EST/Unigene BQ138994 |
Acc. | BQ138994 |
Internal Acc. | NF010A02PH1F1005 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Methylmalonate-semialdehyde dehydrogenase [acylating], mitochondrial OS=Arabidopsis thaliana E-value=1e-36; Probable methylmalonate-semialdehyde dehydrogenase [acylating], mitochondrial OS=Dictyostelium discoideum E-value=7e-20; Probable methylmalonate-semialdehyde dehydrogenase [acylating], mitochondrial OS=Anopheles gambiae E-value=2e-19; Probable methylmalonate-semialdehyde dehydrogenase [acylating], mitochondrial OS=Drosophila melanogaster E-value=2e-19; Probable methylmalonate-semialdehyde dehydrogenase [acylating], mitochondrial OS=Caenorhabditis elegans E-value=2e-19; |
Length | 517 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | CTTCTCGTTTCGTGTCTGGTTCCAAACTGTATCATCCTTAATTTCTTCAAAACCCATTAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00031 Inositol metabolism > K00140 methylmalonate-semialdehyde dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K00140 methylmalonate-semialdehyde dehydrogenase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K00140 methylmalonate-semialdehyde dehydrogenase |
EC | 1.2.1.27 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815903 |
Trichome-related Gene from Literature | N/A |