Detail of EST/Unigene BQ139189 |
Acc. | BQ139189 |
Internal Acc. | NF012F02PH1F1016 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Heme oxygenase 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-41; Heme oxygenase 3, chloroplastic OS=Arabidopsis thaliana E-value=5e-38; Heme oxygenase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-33; Heme oxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=4e-26; Probable inactive heme oxygenase 2, chloroplastic OS=Arabidopsis thaliana E-value=7e-20; |
Length | 668 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | CAATACTAATTTATTCTCAATTGCACATCAAACATATAATACCGCCGTGCACTCAACAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817208 |
Trichome-related Gene from Literature | N/A |