| Detail of EST/Unigene BQ139258 |
| Acc. | BQ139258 |
| Internal Acc. | NF013D02PH1F1014 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Plastoglobulin-1, chloroplastic OS=Pisum sativum E-value=5e-39; Plastid lipid-associated protein 3, chloroplastic OS=Brassica campestris E-value=3e-28; Probable plastid-lipid-associated protein 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-27; Probable plastid-lipid-associated protein 3, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-26; Plastid lipid-associated protein 2, chloroplastic OS=Brassica campestris E-value=2e-15; |
| Length | 559 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA; |
| Sequence | ATCATTCAAACATTTTATATATAATANAATTACAGGTTTACAACACATAGGCTCTGCATC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818114 |
| Trichome-related Gene from Literature | N/A |