| Detail of EST/Unigene BQ139574 |
| Acc. | BQ139574 |
| Internal Acc. | NF021H02PH1F1027 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Isoflavone 2'-hydroxylase OS=Glycyrrhiza echinata E-value=7e-28; Cytochrome P450 81F1 OS=Arabidopsis thaliana E-value=3e-22; Cytochrome P450 81D1 OS=Arabidopsis thaliana E-value=3e-19; Cytochrome P450 750A1 OS=Pinus taeda E-value=4e-17; Cytochrome P450 71A25 OS=Arabidopsis thaliana E-value=1e-15; |
| Length | 422 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA; |
| Sequence | ATTCATGGTCTTATTTGTCTCAAAATTCATCACCAACAAATACTTCAACTCTAAACATGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J |
| EC | 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829887 |
| Trichome-related Gene from Literature | N/A |