Detail of EST/Unigene BQ139892 |
Acc. | BQ139892 |
Internal Acc. | NF026C07PH1F1053 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoglycerate kinase, chloroplastic OS=Nicotiana tabacum E-value=7e-15; Phosphoglycerate kinase, chloroplastic OS=Triticum aestivum E-value=4e-13; Phosphoglycerate kinase 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-13; Phosphoglycerate kinase 1, chloroplastic OS=Arabidopsis thaliana E-value=6e-11; Phosphoglycerate kinase, chloroplastic (Fragment) OS=Spinacia oleracea E-value=1e-10; |
Length | 367 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | CACAAACACACTCTCTCTCTCTCTACAATGGCTTCAGCTACAGCCCCCACAACCATCTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842072 |
Trichome-related Gene from Literature | N/A |