Detail of EST/Unigene BQ139955 |
Acc. | BQ139955 |
Internal Acc. | NF026H08PH1F1075 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Glycine max E-value=0; Glutamate-1-semialdehyde 2,1-aminomutase 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-97; Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Nicotiana tabacum E-value=5e-95; Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-94; Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Hordeum vulgare E-value=5e-94; |
Length | 711 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | ATGTATGGGTGCACTCCGCCTTGCACGTGCTTATACCGGCAAAGAGAAGATCATCAAGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K00819 ornithine--oxo-acid transaminase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K01845 glutamate-1-semialdehyde 2,1-aminomutase |
EC | 2.6.1.13 5.4.3.8 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824034 |
Trichome-related Gene from Literature | N/A |