Detail of EST/Unigene BQ140337 |
Acc. | BQ140337 |
Internal Acc. | NF034D08PH1F1074 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Estradiol 17-beta-dehydrogenase 12 OS=Xenopus tropicalis E-value=3e-11; Inactive hydroxysteroid dehydrogenase-like protein 1 OS=Homo sapiens E-value=5e-11; Hydroxysteroid dehydrogenase-like protein 1 OS=Gallus gallus E-value=6e-11; Estradiol 17-beta-dehydrogenase 12-B OS=Xenopus laevis E-value=8e-11; Inactive hydroxysteroid dehydrogenase-like protein 1 OS=Pongo abelii E-value=1e-10; |
Length | 325 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | CTCTCTTTTTCCTCCTAACATCAACATGGATTGTTGCATAATCAGTAAACTCAAAACCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00044 estradiol 17beta-dehydrogenase; ; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10251 beta-keto reductase |
EC | 1.1.1.- 1.1.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843098 |
Trichome-related Gene from Literature | N/A |