Detail of EST/Unigene BQ140421 |
Acc. | BQ140421 |
Internal Acc. | NF035E09PH1F1071 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase, mitochondrial OS=Pisum sativum E-value=8e-32; Serine hydroxymethyltransferase, mitochondrial OS=Solanum tuberosum E-value=2e-23; Serine hydroxymethyltransferase, mitochondrial OS=Arabidopsis thaliana E-value=2e-22; Serine hydroxymethyltransferase 1, mitochondrial OS=Flaveria pringlei E-value=2e-21; Serine hydroxymethyltransferase 2, mitochondrial OS=Flaveria pringlei E-value=2e-20; |
Length | 303 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | CTCTGAGATGGCAATGGCAATGGCTCTTCGTAGGCTTTCTTCTTCCATCAACAAATCTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829949 |
Trichome-related Gene from Literature | 829949 |