Detail of EST/Unigene BQ140427 |
Acc. | BQ140427 |
Internal Acc. | NF035E06PH1F1051 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin--NADP reductase, chloroplastic OS=Vicia faba E-value=6e-31; Ferredoxin--NADP reductase, leaf isozyme, chloroplastic OS=Pisum sativum E-value=2e-30; Ferredoxin--NADP reductase, chloroplastic OS=Spinacia oleracea E-value=2e-21; Ferredoxin--NADP reductase, leaf-type isozyme, chloroplastic OS=Nicotiana tabacum E-value=5e-21; Ferredoxin--NADP reductase, chloroplastic OS=Mesembryanthemum crystallinum E-value=9e-18; |
Length | 361 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | CACTTAATTAAATAACATTACTCTCTCTCTCTCTCTCTACATTTTCTTGATTCTTCCAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836751 |
Trichome-related Gene from Literature | N/A |