Detail of EST/Unigene BQ140635 |
Acc. | BQ140635 |
Internal Acc. | NF038D03PH1F1030 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | N-alpha-acetyltransferase 35, NatC auxiliary subunit OS=Danio rerio E-value=2e-17; N-alpha-acetyltransferase 35, NatC auxiliary subunit OS=Pongo abelii E-value=4e-17; N-alpha-acetyltransferase 35, NatC auxiliary subunit OS=Macaca fascicularis E-value=4e-17; N-alpha-acetyltransferase 35, NatC auxiliary subunit OS=Homo sapiens E-value=4e-17; N-alpha-acetyltransferase 35, NatC auxiliary subunit OS=Gallus gallus E-value=6e-17; |
Length | 514 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | CTGAAGGAACTCTAAACCTCAAATTAAAGTCACAAACACACCCTCTCTATTCTATTCTAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815566 |
Trichome-related Gene from Literature | N/A |