Detail of EST/Unigene BQ140899 |
Acc. | BQ140899 |
Internal Acc. | NF055A03PH1F1021 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase kinase 5 OS=Arabidopsis thaliana E-value=7e-41; Mitogen-activated protein kinase kinase 4 OS=Arabidopsis thaliana E-value=6e-40; Dual specificity mitogen-activated protein kinase kinase 1 OS=Xenopus laevis E-value=3e-34; Dual specificity mitogen-activated protein kinase kinase 1 OS=Pan troglodytes E-value=1e-33; Dual specificity mitogen-activated protein kinase kinase 1 (Fragment) OS=Serinus canaria E-value=2e-33; |
Length | 622 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | CTACAAACAACCCTCCACTTCAGCCACCACCGCCTCCGTTGCCGGTGGTGACAATATTAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04368 mitogen-activated protein kinase kinase 1 |
EC | 2.7.12.2 |
Transcription Factor Family | WRKY |
Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
Probeset |
|
Corresponding NCBI Gene | 843685 |
Trichome-related Gene from Literature | N/A |