Detail of EST/Unigene BQ141009 |
Acc. | BQ141009 |
Internal Acc. | NF056G10PH1F1084 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chaperone protein ClpC1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-40; Chaperone protein ClpC1, chloroplastic OS=Arabidopsis thaliana E-value=2e-40; Chaperone protein ClpC, chloroplastic OS=Pisum sativum E-value=4e-40; ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplastic OS=Solanum lycopersicum E-value=4e-40; ATP-dependent Clp protease ATP-binding subunit clpA homolog, chloroplastic (Fragment) OS=Brassica napus E-value=8e-40; |
Length | 259 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | TTCGGCACGAGGACCACATTGGATGAATACAGGAAGCACATCGAAAAAGACCCAGCTTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 9.A.3 Mercuric ion (Hg2+) porter-2 MerC |
Probeset |
|
Corresponding NCBI Gene | 835165 |
Trichome-related Gene from Literature | N/A |