Detail of EST/Unigene BQ141013 |
Acc. | BQ141013 |
Internal Acc. | NF056H01PH1F1016 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=6e-62; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=7e-49; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum tuberosum E-value=1e-48; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=1e-47; Oxygen-evolving enhancer protein 1-1, chloroplastic OS=Arabidopsis thaliana E-value=5e-44; |
Length | 379 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | TGGCAGCCTCACTCCAAGCAGCTGCTACTCTCATGCAACCAACCAAGTTACGTAGCAACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836789 |
Trichome-related Gene from Literature | N/A |