| Detail of EST/Unigene BQ141085 |
| Acc. | BQ141085 |
| Internal Acc. | NF058G05PH1F1040 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Casein kinase I isoform delta-like OS=Arabidopsis thaliana E-value=1e-30; Casein kinase I OS=Toxoplasma gondii E-value=9e-24; Casein kinase I OS=Eimeria tenella E-value=1e-23; Casein kinase I isoform epsilon OS=Gallus gallus E-value=2e-23; Casein kinase I isoform delta-A OS=Danio rerio E-value=3e-23; |
| Length | 434 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA; |
| Sequence | AGCAATCCTGAGGGGAGGAGAGACAATCTCTCTCTCTCTCTCTCTCAATAATAAACATCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K08959 casein kinase 1, delta; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K08960 casein kinase 1, epsilon; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K08960 casein kinase 1, epsilon |
| EC | 2.7.11.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843603 |
| Trichome-related Gene from Literature | N/A |