Detail of EST/Unigene BQ141275 |
Acc. | BQ141275 |
Internal Acc. | NF017G10PH1F1084 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Pisum sativum E-value=6e-39; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Phaseolus vulgaris E-value=9e-37; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Arabidopsis thaliana E-value=5e-32; Carotenoid 9,10(9',10')-cleavage dioxygenase OS=Crocus sativus E-value=5e-30; 9-cis-epoxycarotenoid dioxygenase NCED3, chloroplastic OS=Arabidopsis thaliana E-value=8e-09; |
Length | 595 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | ATTTGCATCTTCATAAAGTGATGCAAACAATGCAATGAACTTTACAAATATCAATATTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825527 |
Trichome-related Gene from Literature | N/A |