Detail of EST/Unigene BQ141308 |
Acc. | BQ141308 |
Internal Acc. | NF018B08PH1F1073 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | U-box domain-containing protein 21 OS=Arabidopsis thaliana E-value=4e-37; U-box domain-containing protein 20 OS=Arabidopsis thaliana E-value=2e-35; E3 ubiquitin-protein ligase PUB22 OS=Arabidopsis thaliana E-value=5e-31; E3 ubiquitin-protein ligase PUB23 OS=Arabidopsis thaliana E-value=9e-31; U-box domain-containing protein 26 OS=Arabidopsis thaliana E-value=4e-30; |
Length | 568 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA; |
Sequence | AATCCTTCATTCCAAGAACAAAACAAAAAAAACACAAACACAAATTTCATAAAACAAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03175 TNF receptor-associated factor 6; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K03175 TNF receptor-associated factor 6; Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K09561 STIP1 homology and U-box containing protein 1 |
EC | 6.3.2.19 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833727 |
Trichome-related Gene from Literature | N/A |