| Detail of EST/Unigene BQ141390 |
| Acc. | BQ141390 |
| Internal Acc. | NF019A10PH1F1081 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=5e-46; Glucan endo-1,3-beta-glucosidase A OS=Solanum lycopersicum E-value=5e-44; Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=6e-44; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=1e-43; Lichenase OS=Nicotiana plumbaginifolia E-value=2e-43; |
| Length | 628 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA; |
| Sequence | CTTGGTTTATACTTTGGTATAATTAAAGCAATACATTCTTAAAAAGAAACTCTTCGATTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827320 |
| Trichome-related Gene from Literature | N/A |