| Detail of EST/Unigene BQ146355 |
| Acc. | BQ146355 |
| Internal Acc. | NF047E05FL1F1038 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Carbamoyl-phosphate synthase small chain OS=Pelobacter carbinolicus (strain DSM 2380 / Gra Bd 1) E-value=6e-40; Carbamoyl-phosphate synthase small chain OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=3e-36; Carbamoyl-phosphate synthase small chain OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=4e-36; Carbamoyl-phosphate synthase small chain OS=Thermosynechococcus elongatus (strain BP-1) E-value=6e-35; Carbamoyl-phosphate synthase small chain OS=Rubrivivax gelatinosus (strain NBRC 100245 / IL144) E-value=9e-35; |
| Length | 509 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | AGATGGCAGCCTTATTGGTGTTTTGAGCACTGACAATTCCAAAACAGACGAGGAATTACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase |
| EC | 2.1.3.2 3.5.2.3 6.3.5.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822396 |
| Trichome-related Gene from Literature | N/A |