Detail of EST/Unigene BQ146365 |
Acc. | BQ146365 |
Internal Acc. | NF047F08FL1F1074 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Nucleoside-triphosphatase OS=Pisum sativum E-value=1e-91; Apyrase OS=Solanum tuberosum E-value=1e-55; Guanosine-diphosphatase OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-26; Probable guanosine-diphosphatase OS=Neosartorya fumigata (strain ATCC MYA-4609 / Af293 / CBS 101355 / FGSC A1100) E-value=1e-22; Ectonucleoside triphosphate diphosphohydrolase 5 OS=Ailuropoda melanoleuca E-value=2e-21; |
Length | 653 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | AGAGCAAGCAGAAAGTGTGGTTCCTGAGGACCAGCGCTCCAAGACACCCGTTAGACTTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01510 apyrase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01510 apyrase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01511 nucleoside-diphosphatase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01511 nucleoside-diphosphatase |
EC | 3.6.1.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831946 |
Trichome-related Gene from Literature | N/A |