| Detail of EST/Unigene BQ146377 |
| Acc. | BQ146377 |
| Internal Acc. | NF047F12FL1F1102 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=6e-25; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=6e-24; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=1e-21; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=3e-21; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=4e-12; |
| Length | 236 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | GCACGAGGGAAGAAGCCGAGTCTGCTGTCGAGAAGTTTAACGGCTATGATTACAATGGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828579 |
| Trichome-related Gene from Literature | N/A |