Detail of EST/Unigene BQ146522 |
Acc. | BQ146522 |
Internal Acc. | NF106E09FL1F1071 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxyacylglutathione hydrolase 3, mitochondrial OS=Arabidopsis thaliana E-value=1e-41; Protein ETHE1, mitochondrial OS=Mus musculus E-value=7e-28; Protein ETHE1, mitochondrial OS=Homo sapiens E-value=3e-27; Protein ETHE1, mitochondrial OS=Bos taurus E-value=7e-27; Hydroxyacylglutathione hydrolase OS=Cyanothece sp. (strain ATCC 51142) E-value=6e-06; |
Length | 636 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GCACAATGTCTACAATCTTGTCTATATCCTCTCCATAGAATTCATCATTTCATTATTATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841793 |
Trichome-related Gene from Literature | N/A |