| Detail of EST/Unigene BQ146572 |
| Acc. | BQ146572 |
| Internal Acc. | NF012B01FL1F1012 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Calvin cycle protein CP12-2, chloroplastic OS=Arabidopsis thaliana E-value=8e-26; Calvin cycle protein CP12-1, chloroplastic OS=Arabidopsis thaliana E-value=6e-24; Calvin cycle protein CP12, chloroplastic OS=Chlamydomonas reinhardtii E-value=2e-10; Calvin cycle protein CP12-3, chloroplastic OS=Arabidopsis thaliana E-value=8e-10; |
| Length | 556 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | TGATNCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825414 |
| Trichome-related Gene from Literature | N/A |