Detail of EST/Unigene BQ146825 |
Acc. | BQ146825 |
Internal Acc. | NF028G04FL1F1035 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=8e-52; 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=7e-51; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=4e-50; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=8e-49; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=8e-32; |
Length | 492 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | ACGCTGCTGAAACTGAAACCGGCGCTGATGATTCTGCTGAAGGTTATTTTGTTGAACCAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828579 |
Trichome-related Gene from Literature | N/A |