| Detail of EST/Unigene BQ146879 |
| Acc. | BQ146879 |
| Internal Acc. | NF029C02FL1F1017 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase DHAR2 OS=Arabidopsis thaliana E-value=2e-23; Glutathione S-transferase DHAR1, mitochondrial OS=Arabidopsis thaliana E-value=1e-21; Putative glutathione S-transferase DHAR4 OS=Arabidopsis thaliana E-value=2e-18; Glutathione S-transferase DHAR3, chloroplastic OS=Arabidopsis thaliana E-value=1e-16; Glutathione S-transferase omega-1 OS=Rattus norvegicus E-value=1e-07; |
| Length | 203 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | ATTTCATCGCAAATGGCTCTTGAGGTTGCTGTCAAGGCTGCTGTTGGTGCTCCAACTATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00310 pyrimidodiazepine synthase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 1.5.4.1 1.8.5.1 2.5.1.18 2.8.-.- |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
| Probeset |
|
| Corresponding NCBI Gene | 843864 |
| Trichome-related Gene from Literature | N/A |