Detail of EST/Unigene BQ147023 |
Acc. | BQ147023 |
Internal Acc. | NF030H02FL1F1027 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | DNA-directed RNA polymerase 2, chloroplastic/mitochondrial OS=Nicotiana sylvestris E-value=3e-51; DNA-directed RNA polymerase 2A (Fragment) OS=Nicotiana tabacum E-value=3e-51; DNA-directed RNA polymerase 2B, chloroplastic/mitochondrial OS=Nicotiana tabacum E-value=8e-51; DNA-directed RNA polymerase 1, mitochondrial OS=Nicotiana sylvestris E-value=5e-47; DNA-directed RNA polymerase 1B, mitochondrial OS=Nicotiana tabacum E-value=1e-46; |
Length | 362 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GAGAAGCCAGCTGATGTTTACTCGGGTATAGCAGCTAGGGTATTAGCAATCATGAAAATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.7.7.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831424 |
Trichome-related Gene from Literature | N/A |