| Detail of EST/Unigene BQ147023 |
| Acc. | BQ147023 |
| Internal Acc. | NF030H02FL1F1027 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | DNA-directed RNA polymerase 2, chloroplastic/mitochondrial OS=Nicotiana sylvestris E-value=3e-51; DNA-directed RNA polymerase 2A (Fragment) OS=Nicotiana tabacum E-value=3e-51; DNA-directed RNA polymerase 2B, chloroplastic/mitochondrial OS=Nicotiana tabacum E-value=8e-51; DNA-directed RNA polymerase 1, mitochondrial OS=Nicotiana sylvestris E-value=5e-47; DNA-directed RNA polymerase 1B, mitochondrial OS=Nicotiana tabacum E-value=1e-46; |
| Length | 362 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | GAGAAGCCAGCTGATGTTTACTCGGGTATAGCAGCTAGGGTATTAGCAATCATGAAAATC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.7.7.6 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831424 |
| Trichome-related Gene from Literature | N/A |