Detail of EST/Unigene BQ147622 |
Acc. | BQ147622 |
Internal Acc. | NF044H11FL1F1095 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 2-Cys peroxiredoxin BAS1-like, chloroplastic OS=Arabidopsis thaliana E-value=3e-87; 2-Cys peroxiredoxin BAS1, chloroplastic OS=Arabidopsis thaliana E-value=1e-86; 2-Cys peroxiredoxin BAS1, chloroplastic OS=Spinacia oleracea E-value=2e-83; 2-Cys peroxiredoxin BAS1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-83; 2-Cys peroxiredoxin BAS1, chloroplastic (Fragment) OS=Hordeum vulgare E-value=6e-82; |
Length | 604 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | TCTGAATATATTGGGAAAAAATATGTTATCCTCTTTTTTTACCCATTGGACTTCACATTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.11.1.15 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830517 |
Trichome-related Gene from Literature | N/A |