| Detail of EST/Unigene BQ147752 |
| Acc. | BQ147752 |
| Internal Acc. | NF046D04FL1F1041 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=1e-43; Probable beta-1,3-galactosyltransferase 4 OS=Arabidopsis thaliana E-value=3e-43; Probable beta-1,3-galactosyltransferase 3 OS=Arabidopsis thaliana E-value=9e-42; Probable beta-1,3-galactosyltransferase 6 OS=Arabidopsis thaliana E-value=6e-37; Beta-1,3-galactosyltransferase 7 OS=Arabidopsis thaliana E-value=2e-33; |
| Length | 445 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | GACAACTGTATGCTGTTTCAAAAGATCTTGCCACGTATATTGCNTACAAACAAGAATGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839292 |
| Trichome-related Gene from Literature | N/A |