| Detail of EST/Unigene BQ147869 |
| Acc. | BQ147869 |
| Internal Acc. | NF048B07FL1F1060 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S2, chloroplastic OS=Lotus japonicus E-value=5e-92; 30S ribosomal protein S2, chloroplastic OS=Pisum sativum E-value=8e-92; 30S ribosomal protein S2, chloroplastic OS=Carica papaya E-value=1e-88; 30S ribosomal protein S2, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=2e-88; 30S ribosomal protein S2, chloroplastic OS=Cucumis sativus E-value=3e-88; |
| Length | 676 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | GAAAAGAGAAGGTTCCATCGGAACAATTATTTATTGCTATTTCAGGATACCTGGTCTCGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |