Detail of EST/Unigene BQ147887 |
Acc. | BQ147887 |
Internal Acc. | NF048C11FL1F1085 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ectonucleotide pyrophosphatase/phosphodiesterase family member 3 OS=Rattus norvegicus E-value=6e-16; Ectonucleotide pyrophosphatase/phosphodiesterase family member 1 OS=Mus musculus E-value=8e-16; Ectonucleotide pyrophosphatase/phosphodiesterase family member 1 OS=Homo sapiens E-value=1e-15; Ectonucleotide pyrophosphatase/phosphodiesterase family member 3 OS=Bos taurus E-value=1e-15; Ectonucleotide pyrophosphatase/phosphodiesterase family member 3 OS=Homo sapiens E-value=2e-15; |
Length | 486 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | AATAAGTTGAAGGTGTTTTTGAAGGAAGATTTGCCGAAGCGGCTTCATTATGCCGGAGAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00565 Ether lipid metabolism > K01122 alkylglycerophosphoethanolamine phosphodiesterase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K01513 nucleotide pyrophosphatase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01513 nucleotide pyrophosphatase; Metabolism > Metabolism of Cofactors and Vitamins > ko00760 Nicotinate and nicotinamide metabolism > K01513 nucleotide pyrophosphatase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K01513 nucleotide pyrophosphatase; Metabolism > Metabolism of Cofactors and Vitamins > ko00740 Riboflavin metabolism > K01513 nucleotide pyrophosphatase |
EC | 3.1.4.1 3.1.4.39 3.6.1.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829089 |
Trichome-related Gene from Literature | N/A |