| Detail of EST/Unigene BQ147887 |
| Acc. | BQ147887 |
| Internal Acc. | NF048C11FL1F1085 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ectonucleotide pyrophosphatase/phosphodiesterase family member 3 OS=Rattus norvegicus E-value=6e-16; Ectonucleotide pyrophosphatase/phosphodiesterase family member 1 OS=Mus musculus E-value=8e-16; Ectonucleotide pyrophosphatase/phosphodiesterase family member 1 OS=Homo sapiens E-value=1e-15; Ectonucleotide pyrophosphatase/phosphodiesterase family member 3 OS=Bos taurus E-value=1e-15; Ectonucleotide pyrophosphatase/phosphodiesterase family member 3 OS=Homo sapiens E-value=2e-15; |
| Length | 486 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | AATAAGTTGAAGGTGTTTTTGAAGGAAGATTTGCCGAAGCGGCTTCATTATGCCGGAGAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00565 Ether lipid metabolism > K01122 alkylglycerophosphoethanolamine phosphodiesterase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K01513 nucleotide pyrophosphatase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01513 nucleotide pyrophosphatase; Metabolism > Metabolism of Cofactors and Vitamins > ko00760 Nicotinate and nicotinamide metabolism > K01513 nucleotide pyrophosphatase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K01513 nucleotide pyrophosphatase; Metabolism > Metabolism of Cofactors and Vitamins > ko00740 Riboflavin metabolism > K01513 nucleotide pyrophosphatase |
| EC | 3.1.4.1 3.1.4.39 3.6.1.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829089 |
| Trichome-related Gene from Literature | N/A |