Detail of EST/Unigene BQ147963 |
Acc. | BQ147963 |
Internal Acc. | NF049B05FL1F1044 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L12, chloroplastic OS=Nicotiana tabacum E-value=6e-16; 50S ribosomal protein L12, chloroplastic OS=Nicotiana sylvestris E-value=6e-16; 50S ribosomal protein L12, chloroplastic OS=Spinacia oleracea E-value=5e-15; 50S ribosomal protein L12-3, chloroplastic OS=Arabidopsis thaliana E-value=2e-14; 50S ribosomal protein L12-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-14; |
Length | 555 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GCTTTAACGAGTTTGGGATTGAAAGAAGCGAAGGAATTGATTGAAGGTTTGCCGAAGAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822403 |
Trichome-related Gene from Literature | N/A |