Detail of EST/Unigene BQ148063 |
Acc. | BQ148063 |
Internal Acc. | NF058C11FL1F1086 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit a, chloroplastic OS=Triticum aestivum E-value=1e-17; ATP synthase subunit a, chloroplastic OS=Vitis vinifera E-value=1e-17; ATP synthase subunit a, chloroplastic OS=Trachelium caeruleum E-value=1e-17; ATP synthase subunit a, chloroplastic OS=Staurastrum punctulatum E-value=1e-17; ATP synthase subunit a, chloroplastic OS=Glycine max E-value=1e-17; |
Length | 661 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | AAAACCCTTATCGCTTAGTTTTCGACTTTTCGGAAATATATTAGCTGATGAATTAGTAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |