| Detail of EST/Unigene BQ148097 |
| Acc. | BQ148097 |
| Internal Acc. | NF058E12FL1F1099 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 83B1 OS=Arabidopsis thaliana E-value=1e-39; Cytochrome P450 71A9 OS=Glycine max E-value=4e-34; Cytochrome P450 71A1 OS=Persea americana E-value=4e-34; Cytochrome P450 71B9 OS=Arabidopsis thaliana E-value=6e-33; Angelicin synthase (Fragment) OS=Pastinaca sativa E-value=7e-33; |
| Length | 664 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | CGATTTTCTATCAACAAAGAAAACAAAGTTAACAACTAAATCTCTTTTTCCTTTTCATAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829277 |
| Trichome-related Gene from Literature | N/A |